Book Detail:
Author: Adam Rutherford
Publisher: Weidenfeld & Nicolson
ISBN: 9781780229072
Size: 54.51 MB
Format: PDF, Mobi
Release Date: 2017-09-07
Category:
Language: en
View: 1634
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everyone Who Ever Lived eBook. You can read online on your kindle, Android, iPhone, iPad. This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.
A Brief History Of Everyone Who Ever Lived by Adam Rutherford
Book Detail:
Author: Adam Rutherford
Publisher: Hachette UK
ISBN: 0297609394
Size: 64.57 MB
Format: PDF, Kindle
Release Date: 2016-09-08
Category: Science
Language: en
View: 6331
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everyone Who Ever Lived eBook. You can read online on your kindle, Android, iPhone, iPad. 'A brilliant, authoritative, surprising, captivating introduction to human genetics. You'll be spellbound' Brian Cox This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be. *** 'A thoroughly entertaining history of Homo sapiens and its DNA in a manner that displays popular science writing at its best' Observer 'Magisterial, informative and delightful' Peter Frankopan 'An extraordinary adventure...From the Neanderthals to the Vikings, from the Queen of Sheba to Richard III, Rutherford goes in search of our ancestors, tracing the genetic clues deep into the past' Alice Roberts
Author: Adam Rutherford
Publisher: Hachette UK
ISBN: 0297609394
Size: 64.57 MB
Format: PDF, Kindle
Release Date: 2016-09-08
Category: Science
Language: en
View: 6331
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everyone Who Ever Lived eBook. You can read online on your kindle, Android, iPhone, iPad. 'A brilliant, authoritative, surprising, captivating introduction to human genetics. You'll be spellbound' Brian Cox This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be. *** 'A thoroughly entertaining history of Homo sapiens and its DNA in a manner that displays popular science writing at its best' Observer 'Magisterial, informative and delightful' Peter Frankopan 'An extraordinary adventure...From the Neanderthals to the Vikings, from the Queen of Sheba to Richard III, Rutherford goes in search of our ancestors, tracing the genetic clues deep into the past' Alice Roberts
A Brief History Of Everyone Who Ever Lived by Adam Rutherford
Book Detail:
Author: Adam Rutherford
Publisher:
ISBN: 9780297609377
Size: 13.59 MB
Format: PDF, Kindle
Release Date: 2016
Category: Human beings
Language: en
View: 4007
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everyone Who Ever Lived eBook. You can read online on your kindle, Android, iPhone, iPad. This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.
Author: Adam Rutherford
Publisher:
ISBN: 9780297609377
Size: 13.59 MB
Format: PDF, Kindle
Release Date: 2016
Category: Human beings
Language: en
View: 4007
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everyone Who Ever Lived eBook. You can read online on your kindle, Android, iPhone, iPad. This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.
The Book Of Humans by Adam Rutherford
Book Detail:
Author: Adam Rutherford
Publisher: The Experiment
ISBN: 1615195327
Size: 46.10 MB
Format: PDF, ePub, Docs
Release Date: 2019-03-19
Category: Science
Language: en
View: 567
Status: Available
Get Book
Book Description
Download PDF The Book Of Humans eBook. You can read online on your kindle, Android, iPhone, iPad. Now in paperback: From the author of the acclaimed A Brief History of Everyone Who Ever Lived (57,000 copies in print), a magisterial exploration of the paradox of our identity as animals—both within the animal kingdom, yet distinct from all others
Author: Adam Rutherford
Publisher: The Experiment
ISBN: 1615195327
Size: 46.10 MB
Format: PDF, ePub, Docs
Release Date: 2019-03-19
Category: Science
Language: en
View: 567
Status: Available
Get Book
Book Description
Download PDF The Book Of Humans eBook. You can read online on your kindle, Android, iPhone, iPad. Now in paperback: From the author of the acclaimed A Brief History of Everyone Who Ever Lived (57,000 copies in print), a magisterial exploration of the paradox of our identity as animals—both within the animal kingdom, yet distinct from all others
A Brief History Of Everyone Who Ever Lived by Adam Rutherford
Book Detail:
Author: Adam Rutherford
Publisher: The Experiment
ISBN: 1615194940
Size: 45.57 MB
Format: PDF, Docs
Release Date: 2018-09-04
Category: Science
Language: en
View: 7760
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everyone Who Ever Lived eBook. You can read online on your kindle, Android, iPhone, iPad. National Book Critics Circle Award—2017 Nonfiction Finalist “Nothing less than a tour de force—a heady amalgam of science, history, a little bit of anthropology and plenty of nuanced, captivating storytelling.”—The New York Times Book Review, Editor's Choice A National Geographic Best Book of 2017 In our unique genomes, every one of us carries the story of our species—births, deaths, disease, war, famine, migration, and a lot of sex. But those stories have always been locked away—until now. Who are our ancestors? Where did they come from? Geneticists have suddenly become historians, and the hard evidence in our DNA has blown the lid off what we thought we knew. Acclaimed science writer Adam Rutherford explains exactly how genomics is completely rewriting the human story—from 100,000 years ago to the present.
Author: Adam Rutherford
Publisher: The Experiment
ISBN: 1615194940
Size: 45.57 MB
Format: PDF, Docs
Release Date: 2018-09-04
Category: Science
Language: en
View: 7760
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everyone Who Ever Lived eBook. You can read online on your kindle, Android, iPhone, iPad. National Book Critics Circle Award—2017 Nonfiction Finalist “Nothing less than a tour de force—a heady amalgam of science, history, a little bit of anthropology and plenty of nuanced, captivating storytelling.”—The New York Times Book Review, Editor's Choice A National Geographic Best Book of 2017 In our unique genomes, every one of us carries the story of our species—births, deaths, disease, war, famine, migration, and a lot of sex. But those stories have always been locked away—until now. Who are our ancestors? Where did they come from? Geneticists have suddenly become historians, and the hard evidence in our DNA has blown the lid off what we thought we knew. Acclaimed science writer Adam Rutherford explains exactly how genomics is completely rewriting the human story—from 100,000 years ago to the present.
Creation by Adam Rutherford
Book Detail:
Author: Adam Rutherford
Publisher: Penguin UK
ISBN: 0141970227
Size: 70.41 MB
Format: PDF, Kindle
Release Date: 2013-04-04
Category: Science
Language: en
View: 1263
Status: Available
Get Book
Book Description
Download PDF Creation eBook. You can read online on your kindle, Android, iPhone, iPad. 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Author: Adam Rutherford
Publisher: Penguin UK
ISBN: 0141970227
Size: 70.41 MB
Format: PDF, Kindle
Release Date: 2013-04-04
Category: Science
Language: en
View: 1263
Status: Available
Get Book
Book Description
Download PDF Creation eBook. You can read online on your kindle, Android, iPhone, iPad. 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
How To Argue With A Racist by Adam Rutherford
Book Detail:
Author: Adam Rutherford
Publisher: Hachette UK
ISBN: 1615196722
Size: 13.67 MB
Format: PDF, ePub, Docs
Release Date: 2020-08-04
Category: Social Science
Language: en
View: 910
Status: Available
Get Book
Book Description
Download PDF How To Argue With A Racist eBook. You can read online on your kindle, Android, iPhone, iPad. Racist pseudoscience is on the rise. Neo-Nazis and white supremacists are obsessed with genetics, as they believe it will prove their racial purity. But they don’t know what they’re talking about. Learn why in this timely, authoritative weapon against the misuse of science to justify bigotry.
Author: Adam Rutherford
Publisher: Hachette UK
ISBN: 1615196722
Size: 13.67 MB
Format: PDF, ePub, Docs
Release Date: 2020-08-04
Category: Social Science
Language: en
View: 910
Status: Available
Get Book
Book Description
Download PDF How To Argue With A Racist eBook. You can read online on your kindle, Android, iPhone, iPad. Racist pseudoscience is on the rise. Neo-Nazis and white supremacists are obsessed with genetics, as they believe it will prove their racial purity. But they don’t know what they’re talking about. Learn why in this timely, authoritative weapon against the misuse of science to justify bigotry.
The Brief History Of The Dead by Kevin Brockmeier
Book Detail:
Author: Kevin Brockmeier
Publisher: Vintage
ISBN: 1400095956
Size: 34.62 MB
Format: PDF, ePub, Docs
Release Date: 2007-01-09
Category: Fiction
Language: en
View: 6745
Status: Available
Get Book
Book Description
Download PDF The Brief History Of The Dead eBook. You can read online on your kindle, Android, iPhone, iPad. From Kevin Brockmeier, one of this generation's most inventive young writers, comes a striking new novel about death, life, and the mysterious place in between. The City is inhabited by those who have departed Earth but are still remembered by the living. They will reside in this afterlife until they are completely forgotten. But the City is shrinking, and the residents clearing out. Some of the holdouts, like Luka Sims, who produces the City’s only newspaper, are wondering what exactly is going on. Others, like Coleman Kinzler, believe it is the beginning of the end. Meanwhile, Laura Byrd is trapped in an Antarctic research station, her supplies are running low, her radio finds only static, and the power is failing. With little choice, Laura sets out across the ice to look for help, but time is running out. Kevin Brockmeier alternates these two storylines to create a lyrical and haunting story about love, loss and the power of memory.
Author: Kevin Brockmeier
Publisher: Vintage
ISBN: 1400095956
Size: 34.62 MB
Format: PDF, ePub, Docs
Release Date: 2007-01-09
Category: Fiction
Language: en
View: 6745
Status: Available
Get Book
Book Description
Download PDF The Brief History Of The Dead eBook. You can read online on your kindle, Android, iPhone, iPad. From Kevin Brockmeier, one of this generation's most inventive young writers, comes a striking new novel about death, life, and the mysterious place in between. The City is inhabited by those who have departed Earth but are still remembered by the living. They will reside in this afterlife until they are completely forgotten. But the City is shrinking, and the residents clearing out. Some of the holdouts, like Luka Sims, who produces the City’s only newspaper, are wondering what exactly is going on. Others, like Coleman Kinzler, believe it is the beginning of the end. Meanwhile, Laura Byrd is trapped in an Antarctic research station, her supplies are running low, her radio finds only static, and the power is failing. With little choice, Laura sets out across the ice to look for help, but time is running out. Kevin Brockmeier alternates these two storylines to create a lyrical and haunting story about love, loss and the power of memory.
Me Myself And Why by Jennifer Ouellette
Book Detail:
Author: Jennifer Ouellette
Publisher: Penguin
ISBN: 1101613645
Size: 40.81 MB
Format: PDF, ePub
Release Date: 2014-01-28
Category: Science
Language: en
View: 592
Status: Available
Get Book
Book Description
Download PDF Me Myself And Why eBook. You can read online on your kindle, Android, iPhone, iPad. As diverse as people appear to be, all of our genes and brains are nearly identical. In Me, Myself, and Why, Jennifer Ouellette dives into the miniscule ranges of variation to understand just what sets us apart. She draws on cutting-edge research in genetics, neuroscience, and psychology-enlivened as always with her signature sense of humor-to explore the mysteries of human identity and behavior. Readers follow her own surprising journey of self-discovery as she has her genome sequenced, her brain mapped, her personality typed, and even samples a popular hallucinogen. Bringing together everything from Mendel's famous pea plant experiments and mutations in The X-Men to our taste for cilantro and our relationships with virtual avatars, Ouellette takes us on an endlessly thrilling and illuminating trip into the science of ourselves
Author: Jennifer Ouellette
Publisher: Penguin
ISBN: 1101613645
Size: 40.81 MB
Format: PDF, ePub
Release Date: 2014-01-28
Category: Science
Language: en
View: 592
Status: Available
Get Book
Book Description
Download PDF Me Myself And Why eBook. You can read online on your kindle, Android, iPhone, iPad. As diverse as people appear to be, all of our genes and brains are nearly identical. In Me, Myself, and Why, Jennifer Ouellette dives into the miniscule ranges of variation to understand just what sets us apart. She draws on cutting-edge research in genetics, neuroscience, and psychology-enlivened as always with her signature sense of humor-to explore the mysteries of human identity and behavior. Readers follow her own surprising journey of self-discovery as she has her genome sequenced, her brain mapped, her personality typed, and even samples a popular hallucinogen. Bringing together everything from Mendel's famous pea plant experiments and mutations in The X-Men to our taste for cilantro and our relationships with virtual avatars, Ouellette takes us on an endlessly thrilling and illuminating trip into the science of ourselves
Sapiens by Yuval Noah Harari
Book Detail:
Author: Yuval Noah Harari
Publisher: Harper Collins
ISBN: 0062316109
Size: 78.76 MB
Format: PDF, ePub, Mobi
Release Date: 2015-02-10
Category: Science
Language: en
View: 3306
Status: Available
Get Book
Book Description
Download PDF Sapiens eBook. You can read online on your kindle, Android, iPhone, iPad. New York Times Bestseller A Summer Reading Pick for President Barack Obama, Bill Gates, and Mark Zuckerberg From a renowned historian comes a groundbreaking narrative of humanity’s creation and evolution—a #1 international bestseller—that explores the ways in which biology and history have defined us and enhanced our understanding of what it means to be “human.” One hundred thousand years ago, at least six different species of humans inhabited Earth. Yet today there is only one—homo sapiens. What happened to the others? And what may happen to us? Most books about the history of humanity pursue either a historical or a biological approach, but Dr. Yuval Noah Harari breaks the mold with this highly original book that begins about 70,000 years ago with the appearance of modern cognition. From examining the role evolving humans have played in the global ecosystem to charting the rise of empires, Sapiens integrates history and science to reconsider accepted narratives, connect past developments with contemporary concerns, and examine specific events within the context of larger ideas. Dr. Harari also compels us to look ahead, because over the last few decades humans have begun to bend laws of natural selection that have governed life for the past four billion years. We are acquiring the ability to design not only the world around us, but also ourselves. Where is this leading us, and what do we want to become? Featuring 27 photographs, 6 maps, and 25 illustrations/diagrams, this provocative and insightful work is sure to spark debate and is essential reading for aficionados of Jared Diamond, James Gleick, Matt Ridley, Robert Wright, and Sharon Moalem.
Author: Yuval Noah Harari
Publisher: Harper Collins
ISBN: 0062316109
Size: 78.76 MB
Format: PDF, ePub, Mobi
Release Date: 2015-02-10
Category: Science
Language: en
View: 3306
Status: Available
Get Book
Book Description
Download PDF Sapiens eBook. You can read online on your kindle, Android, iPhone, iPad. New York Times Bestseller A Summer Reading Pick for President Barack Obama, Bill Gates, and Mark Zuckerberg From a renowned historian comes a groundbreaking narrative of humanity’s creation and evolution—a #1 international bestseller—that explores the ways in which biology and history have defined us and enhanced our understanding of what it means to be “human.” One hundred thousand years ago, at least six different species of humans inhabited Earth. Yet today there is only one—homo sapiens. What happened to the others? And what may happen to us? Most books about the history of humanity pursue either a historical or a biological approach, but Dr. Yuval Noah Harari breaks the mold with this highly original book that begins about 70,000 years ago with the appearance of modern cognition. From examining the role evolving humans have played in the global ecosystem to charting the rise of empires, Sapiens integrates history and science to reconsider accepted narratives, connect past developments with contemporary concerns, and examine specific events within the context of larger ideas. Dr. Harari also compels us to look ahead, because over the last few decades humans have begun to bend laws of natural selection that have governed life for the past four billion years. We are acquiring the ability to design not only the world around us, but also ourselves. Where is this leading us, and what do we want to become? Featuring 27 photographs, 6 maps, and 25 illustrations/diagrams, this provocative and insightful work is sure to spark debate and is essential reading for aficionados of Jared Diamond, James Gleick, Matt Ridley, Robert Wright, and Sharon Moalem.
The Shortest History Of Germany by James Hawes
Book Detail:
Author: James Hawes
Publisher: The Experiment
ISBN: 1615195696
Size: 17.18 MB
Format: PDF
Release Date: 2019-03-19
Category: History
Language: en
View: 1319
Status: Available
Get Book
Book Description
Download PDF The Shortest History Of Germany eBook. You can read online on your kindle, Android, iPhone, iPad. 2,000 years of history in one riveting afternoon A country both admired and feared, Germany has been the epicenter of world events time and again: the Reformation, both World Wars, the fall of the Berlin Wall. It did not emerge as a modern nation until 1871—yet today, Germany is the world’s fourth-largest economy and a standard-bearer of liberal democracy. “There’s no point studying the past unless it sheds some light on the present,” writes James Hawes in this brilliantly concise history that has already captivated hundreds of thousands of readers. “It is time, now more than ever, for us all to understand the real history of Germany.”
Author: James Hawes
Publisher: The Experiment
ISBN: 1615195696
Size: 17.18 MB
Format: PDF
Release Date: 2019-03-19
Category: History
Language: en
View: 1319
Status: Available
Get Book
Book Description
Download PDF The Shortest History Of Germany eBook. You can read online on your kindle, Android, iPhone, iPad. 2,000 years of history in one riveting afternoon A country both admired and feared, Germany has been the epicenter of world events time and again: the Reformation, both World Wars, the fall of the Berlin Wall. It did not emerge as a modern nation until 1871—yet today, Germany is the world’s fourth-largest economy and a standard-bearer of liberal democracy. “There’s no point studying the past unless it sheds some light on the present,” writes James Hawes in this brilliantly concise history that has already captivated hundreds of thousands of readers. “It is time, now more than ever, for us all to understand the real history of Germany.”
A Brief History Of Living Forever by Jaroslav Kalfar
Book Detail:
Author: Jaroslav Kalfar
Publisher: Little, Brown
ISBN: 0316463205
Size: 32.82 MB
Format: PDF, Docs
Release Date: 2023-03-28
Category: Fiction
Language: en
View: 7603
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Living Forever eBook. You can read online on your kindle, Android, iPhone, iPad. In this “ingenious, funny, and chilling” novel (Publishers Weekly, starred review) from the author of Spaceman of Bohemia, two long-lost siblings risk everything to save their mother from oblivion in an authoritarian near-future America obsessed with digital consciousness and eternal life—a story that “packs a walloping punch” (Esquire). When Adéla discovers she has a terminal illness, she leaves behind her native Czech village for a chance at reuniting in America with Tereza, the daughter she gave up at birth, decades earlier. But the country Adéla experienced as a young woman, when she eloped with a filmmaker and starred in his cult sci-fi movie, has changed entirely. In 2030, America is ruled by an authoritarian government increasingly closed off to the rest of the world. Tereza, the star researcher for VITA, a biotech company hellbent on discovering the key to immortality, is overjoyed to meet her mother, with whom she forms an instant, profound connection. But when their time together is cut short by shocking events, Tereza must uncover VITA’s alarming activity in the wastelands of what was once Florida, and persuade the Czech brother she’s never met to join her in this odds-defying adventure. Narrated from the beyond by Adéla’s restless spirit, A Brief History of Living Forever is a high-wire act of storytelling from a writer “booming with vitality and originality,” whose “voice is distinct enough to leave tread marks” (New York Times). By turns insightful, moving, and funny, the novel not only confirms Jaroslav Kalfař’s boundless powers of invention but also exults in the love between a mother and her daughter, which neither space nor time can sever. “Kalfař is a wise, rapturous, and original writer . . . Eloquent, heart-stunning, and rich in awe-inspiring prose.” —San Francisco Chronicle “Relentlessly inventive . . . His writing has the same hyperactivity and fidgety contempt for generic boundaries as that of the young Safran Foer.” —The Guardian
Author: Jaroslav Kalfar
Publisher: Little, Brown
ISBN: 0316463205
Size: 32.82 MB
Format: PDF, Docs
Release Date: 2023-03-28
Category: Fiction
Language: en
View: 7603
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Living Forever eBook. You can read online on your kindle, Android, iPhone, iPad. In this “ingenious, funny, and chilling” novel (Publishers Weekly, starred review) from the author of Spaceman of Bohemia, two long-lost siblings risk everything to save their mother from oblivion in an authoritarian near-future America obsessed with digital consciousness and eternal life—a story that “packs a walloping punch” (Esquire). When Adéla discovers she has a terminal illness, she leaves behind her native Czech village for a chance at reuniting in America with Tereza, the daughter she gave up at birth, decades earlier. But the country Adéla experienced as a young woman, when she eloped with a filmmaker and starred in his cult sci-fi movie, has changed entirely. In 2030, America is ruled by an authoritarian government increasingly closed off to the rest of the world. Tereza, the star researcher for VITA, a biotech company hellbent on discovering the key to immortality, is overjoyed to meet her mother, with whom she forms an instant, profound connection. But when their time together is cut short by shocking events, Tereza must uncover VITA’s alarming activity in the wastelands of what was once Florida, and persuade the Czech brother she’s never met to join her in this odds-defying adventure. Narrated from the beyond by Adéla’s restless spirit, A Brief History of Living Forever is a high-wire act of storytelling from a writer “booming with vitality and originality,” whose “voice is distinct enough to leave tread marks” (New York Times). By turns insightful, moving, and funny, the novel not only confirms Jaroslav Kalfař’s boundless powers of invention but also exults in the love between a mother and her daughter, which neither space nor time can sever. “Kalfař is a wise, rapturous, and original writer . . . Eloquent, heart-stunning, and rich in awe-inspiring prose.” —San Francisco Chronicle “Relentlessly inventive . . . His writing has the same hyperactivity and fidgety contempt for generic boundaries as that of the young Safran Foer.” —The Guardian
A Brief History Of Misogyny by Jack Holland
Book Detail:
Author: Jack Holland
Publisher: Robinson
ISBN: 1780338848
Size: 36.11 MB
Format: PDF, ePub
Release Date: 2012-06-07
Category: Literary Criticism
Language: en
View: 6205
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Misogyny eBook. You can read online on your kindle, Android, iPhone, iPad. In this compelling, powerful book, highly respected writer and commentator Jack Holland sets out to answer a daunting question: how do you explain the oppression and brutalization of half the world's population by the other half, throughout history? The result takes the reader on an eye-opening journey through centuries, continents and civilizations as it looks at both historical and contemporary attitudes to women. Encompassing the Church, witch hunts, sexual theory, Nazism and pro-life campaigners, we arrive at today's developing world, where women are increasingly and disproportionately at risk because of radicalised religious belief, famine, war and disease. Well-informed and researched, highly readable and thought-provoking, this is no outmoded feminist polemic: it's a refreshingly straightforward investigation into an ancient, pervasive and enduring injustice. It deals with the fundamentals of human existence -- sex, love, violence -- that have shaped the lives of humans throughout history. The answer? It's time to recognize that the treatment of women amounts to nothing less than an abuse of human rights on an unthinkable scale. A Brief History of Misogyny is an important and timely book that will make a long-lasting contribution to the efforts to improve those rights throughout the world.
Author: Jack Holland
Publisher: Robinson
ISBN: 1780338848
Size: 36.11 MB
Format: PDF, ePub
Release Date: 2012-06-07
Category: Literary Criticism
Language: en
View: 6205
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Misogyny eBook. You can read online on your kindle, Android, iPhone, iPad. In this compelling, powerful book, highly respected writer and commentator Jack Holland sets out to answer a daunting question: how do you explain the oppression and brutalization of half the world's population by the other half, throughout history? The result takes the reader on an eye-opening journey through centuries, continents and civilizations as it looks at both historical and contemporary attitudes to women. Encompassing the Church, witch hunts, sexual theory, Nazism and pro-life campaigners, we arrive at today's developing world, where women are increasingly and disproportionately at risk because of radicalised religious belief, famine, war and disease. Well-informed and researched, highly readable and thought-provoking, this is no outmoded feminist polemic: it's a refreshingly straightforward investigation into an ancient, pervasive and enduring injustice. It deals with the fundamentals of human existence -- sex, love, violence -- that have shaped the lives of humans throughout history. The answer? It's time to recognize that the treatment of women amounts to nothing less than an abuse of human rights on an unthinkable scale. A Brief History of Misogyny is an important and timely book that will make a long-lasting contribution to the efforts to improve those rights throughout the world.
The Complete Guide To Absolutely Everything Abridged Adventures In Math And Science by Adam Rutherford
Book Detail:
Author: Adam Rutherford
Publisher: W. W. Norton & Company
ISBN: 039388158X
Size: 69.70 MB
Format: PDF, ePub, Docs
Release Date: 2022-01-25
Category: Science
Language: en
View: 2678
Status: Available
Get Book
Book Description
Download PDF The Complete Guide To Absolutely Everything Abridged Adventures In Math And Science eBook. You can read online on your kindle, Android, iPhone, iPad. The complete story of the universe and absolutely everything in it (minus the boring parts). Despite our clever linguistic abilities, humans are spectacularly ill-equipped to comprehend what’s happening in the universe. Our senses and intuition routinely mislead us. The Complete Guide to Absolutely Everything (Abridged) tells the story of how we came to suppress our monkey minds and perceive the true nature of reality. Written with wit and humor, this brief book tells the story of science—tales of fumbles and missteps, errors and egos, hard work, accidents, and some really bad decisions—all of which have created the sum total of human knowledge. Geneticist Adam Rutherford and mathematician Hannah Fry guide readers through time and space, through our bodies and brains, showing how emotions shape our view of reality, how our minds tell us lies, and why a mostly bald and curious ape decided to begin poking at the fabric of the universe. Rutherford and Fry shine as science sleuths, wrestling with some truly head-scratching questions: Where did time come from? Do we have free will? Does my dog love me? Hilarious sidebars present memorable scientific oddities: for example, hypnotized snails, human-sized ants, and the average time it takes most animals to evacuate their bladders. (A surprisingly consistent twenty-one seconds, if you must know.) Both rigorous and playful, The Complete Guide to Absolutely Everything (Abridged) is a celebration of the weirdness of the cosmos, the strangeness of humans, and the joys and follies of scientific discovery.
Author: Adam Rutherford
Publisher: W. W. Norton & Company
ISBN: 039388158X
Size: 69.70 MB
Format: PDF, ePub, Docs
Release Date: 2022-01-25
Category: Science
Language: en
View: 2678
Status: Available
Get Book
Book Description
Download PDF The Complete Guide To Absolutely Everything Abridged Adventures In Math And Science eBook. You can read online on your kindle, Android, iPhone, iPad. The complete story of the universe and absolutely everything in it (minus the boring parts). Despite our clever linguistic abilities, humans are spectacularly ill-equipped to comprehend what’s happening in the universe. Our senses and intuition routinely mislead us. The Complete Guide to Absolutely Everything (Abridged) tells the story of how we came to suppress our monkey minds and perceive the true nature of reality. Written with wit and humor, this brief book tells the story of science—tales of fumbles and missteps, errors and egos, hard work, accidents, and some really bad decisions—all of which have created the sum total of human knowledge. Geneticist Adam Rutherford and mathematician Hannah Fry guide readers through time and space, through our bodies and brains, showing how emotions shape our view of reality, how our minds tell us lies, and why a mostly bald and curious ape decided to begin poking at the fabric of the universe. Rutherford and Fry shine as science sleuths, wrestling with some truly head-scratching questions: Where did time come from? Do we have free will? Does my dog love me? Hilarious sidebars present memorable scientific oddities: for example, hypnotized snails, human-sized ants, and the average time it takes most animals to evacuate their bladders. (A surprisingly consistent twenty-one seconds, if you must know.) Both rigorous and playful, The Complete Guide to Absolutely Everything (Abridged) is a celebration of the weirdness of the cosmos, the strangeness of humans, and the joys and follies of scientific discovery.
A Pocket History Of Human Evolution by Silvana Condemi
Book Detail:
Author: Silvana Condemi
Publisher: The Experiment
ISBN: 1615196048
Size: 34.30 MB
Format: PDF, Mobi
Release Date: 2019-11-01
Category: Science
Language: en
View: 5477
Status: Available
Get Book
Book Description
Download PDF A Pocket History Of Human Evolution eBook. You can read online on your kindle, Android, iPhone, iPad. Why aren’t we more like other apes? How did we win the evolutionary race? Find out how “wise” Homo sapiens really are. Prehistory has never been more exciting: New discoveries are overturning long-held theories left and right. Stone tools in Australia date back 65,000 years—a time when, we once thought, the first Sapiens had barely left Africa. DNA sequencing has unearthed a new hominid group—the Denisovans—and confirmed that crossbreeding with them (and Neanderthals) made Homo sapiens who we are today. A Pocket History of Human Evolution brings us up-to-date on the exploits of all our ancient relatives. Paleoanthropologist Silvana Condemi and science journalist François Savatier consider what accelerated our evolution: Was it tools, our “large” brains, language, empathy, or something else entirely? And why are we the sole surviviors among many early bipedal humans? Their conclusions reveal the various ways ancient humans live on today—from gossip as modern “grooming” to our gendered division of labor—and what the future might hold for our strange and unique species.
Author: Silvana Condemi
Publisher: The Experiment
ISBN: 1615196048
Size: 34.30 MB
Format: PDF, Mobi
Release Date: 2019-11-01
Category: Science
Language: en
View: 5477
Status: Available
Get Book
Book Description
Download PDF A Pocket History Of Human Evolution eBook. You can read online on your kindle, Android, iPhone, iPad. Why aren’t we more like other apes? How did we win the evolutionary race? Find out how “wise” Homo sapiens really are. Prehistory has never been more exciting: New discoveries are overturning long-held theories left and right. Stone tools in Australia date back 65,000 years—a time when, we once thought, the first Sapiens had barely left Africa. DNA sequencing has unearthed a new hominid group—the Denisovans—and confirmed that crossbreeding with them (and Neanderthals) made Homo sapiens who we are today. A Pocket History of Human Evolution brings us up-to-date on the exploits of all our ancient relatives. Paleoanthropologist Silvana Condemi and science journalist François Savatier consider what accelerated our evolution: Was it tools, our “large” brains, language, empathy, or something else entirely? And why are we the sole surviviors among many early bipedal humans? Their conclusions reveal the various ways ancient humans live on today—from gossip as modern “grooming” to our gendered division of labor—and what the future might hold for our strange and unique species.
Creation by Adam Rutherford
Book Detail:
Author: Adam Rutherford
Publisher: Penguin
ISBN: 1101622628
Size: 43.38 MB
Format: PDF, Mobi
Release Date: 2013-06-13
Category: Science
Language: en
View: 5852
Status: Available
Get Book
Book Description
Download PDF Creation eBook. You can read online on your kindle, Android, iPhone, iPad. What is life? Humans have been asking this question for thousands of years. But as technology has advanced and our understanding of biology has deepened, the answer has evolved. For decades, scientists have been exploring the limits of nature by modifying and manipulating DNA, cells and whole organisms to create new ones that could never have existed on their own. In Creation, science writer Adam Rutherford explains how we are now radically exceeding the boundaries of evolution and engineering entirely novel creatures—from goats that produce spider silk in their milk to bacteria that excrete diesel to genetic circuits that identify and destroy cancer cells. As strange as some of these creations may sound, this new, synthetic biology is helping scientists develop radical solutions to some of the world’s most pressing crises—from food shortages to pandemic disease to climate change—and is paving the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? We know that every creature on Earth came from a single cell, sparked into existence four billion years ago. And as we come closer and closer to understanding the ancient root that connects all living things, we may finally be able to achieve a second genesis—the creation of new life where none existed before. Creation takes us on a journey four billion years in the making—from the very first cell to the ground-breaking biological inventions that will shape the future of our planet.
Author: Adam Rutherford
Publisher: Penguin
ISBN: 1101622628
Size: 43.38 MB
Format: PDF, Mobi
Release Date: 2013-06-13
Category: Science
Language: en
View: 5852
Status: Available
Get Book
Book Description
Download PDF Creation eBook. You can read online on your kindle, Android, iPhone, iPad. What is life? Humans have been asking this question for thousands of years. But as technology has advanced and our understanding of biology has deepened, the answer has evolved. For decades, scientists have been exploring the limits of nature by modifying and manipulating DNA, cells and whole organisms to create new ones that could never have existed on their own. In Creation, science writer Adam Rutherford explains how we are now radically exceeding the boundaries of evolution and engineering entirely novel creatures—from goats that produce spider silk in their milk to bacteria that excrete diesel to genetic circuits that identify and destroy cancer cells. As strange as some of these creations may sound, this new, synthetic biology is helping scientists develop radical solutions to some of the world’s most pressing crises—from food shortages to pandemic disease to climate change—and is paving the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? We know that every creature on Earth came from a single cell, sparked into existence four billion years ago. And as we come closer and closer to understanding the ancient root that connects all living things, we may finally be able to achieve a second genesis—the creation of new life where none existed before. Creation takes us on a journey four billion years in the making—from the very first cell to the ground-breaking biological inventions that will shape the future of our planet.
Mobile Design And Development by Brian Fling
Book Detail:
Author: Brian Fling
Publisher: "O'Reilly Media, Inc."
ISBN: 9781449379247
Size: 32.14 MB
Format: PDF, ePub, Docs
Release Date: 2009-08-14
Category: Computers
Language: en
View: 4828
Status: Available
Get Book
Book Description
Download PDF Mobile Design And Development eBook. You can read online on your kindle, Android, iPhone, iPad. Mobile devices outnumber desktop and laptop computers three to one worldwide, yet little information is available for designing and developing mobile applications. Mobile Design and Development fills that void with practical guidelines, standards, techniques, and best practices for building mobile products from start to finish. With this book, you'll learn basic design and development principles for all mobile devices and platforms. You'll also explore the more advanced capabilities of the mobile web, including markup, advanced styling techniques, and mobile Ajax. If you're a web designer, web developer, information architect, product manager, usability professional, content publisher, or an entrepreneur new to the mobile web, Mobile Design and Development provides you with the knowledge you need to work with this rapidly developing technology. Mobile Design and Development will help you: Understand how the mobile ecosystem works, how it differs from other mediums, and how to design products for the mobile context Learn the pros and cons of building native applications sold through operators or app stores versus mobile websites or web apps Work with flows, prototypes, usability practices, and screen-size-independent visual designs Use and test cross-platform mobile web standards for older devices, as well as devices that may be available in the future Learn how to justify a mobile product by building it on a budget
Author: Brian Fling
Publisher: "O'Reilly Media, Inc."
ISBN: 9781449379247
Size: 32.14 MB
Format: PDF, ePub, Docs
Release Date: 2009-08-14
Category: Computers
Language: en
View: 4828
Status: Available
Get Book
Book Description
Download PDF Mobile Design And Development eBook. You can read online on your kindle, Android, iPhone, iPad. Mobile devices outnumber desktop and laptop computers three to one worldwide, yet little information is available for designing and developing mobile applications. Mobile Design and Development fills that void with practical guidelines, standards, techniques, and best practices for building mobile products from start to finish. With this book, you'll learn basic design and development principles for all mobile devices and platforms. You'll also explore the more advanced capabilities of the mobile web, including markup, advanced styling techniques, and mobile Ajax. If you're a web designer, web developer, information architect, product manager, usability professional, content publisher, or an entrepreneur new to the mobile web, Mobile Design and Development provides you with the knowledge you need to work with this rapidly developing technology. Mobile Design and Development will help you: Understand how the mobile ecosystem works, how it differs from other mediums, and how to design products for the mobile context Learn the pros and cons of building native applications sold through operators or app stores versus mobile websites or web apps Work with flows, prototypes, usability practices, and screen-size-independent visual designs Use and test cross-platform mobile web standards for older devices, as well as devices that may be available in the future Learn how to justify a mobile product by building it on a budget
Origin by Jennifer Raff
Book Detail:
Author: Jennifer Raff
Publisher: Twelve
ISBN: 153874970X
Size: 50.90 MB
Format: PDF, ePub, Docs
Release Date: 2022-02-08
Category: Science
Language: en
View: 6509
Status: Available
Get Book
Book Description
Download PDF Origin eBook. You can read online on your kindle, Android, iPhone, iPad. AN INSTANT NEW YORK TIMES BESTSELLER! From celebrated anthropologist Jennifer Raff comes the untold story—and fascinating mystery—of how humans migrated to the Americas. ORIGIN is the story of who the first peoples in the Americas were, how and why they made the crossing, how they dispersed south, and how they lived based on a new and powerful kind of evidence: their complete genomes. ORIGIN provides an overview of these new histories throughout North and South America, and a glimpse into how the tools of genetics reveal details about human history and evolution. 20,000 years ago, people crossed a great land bridge from Siberia into Western Alaska and then dispersed southward into what is now called the Americas. Until we venture out to other worlds, this remains the last time our species has populated an entirely new place, and this event has been a subject of deep fascination and controversy. No written records—and scant archaeological evidence—exist to tell us what happened or how it took place. Many different models have been proposed to explain how the Americas were peopled and what happened in the thousands of years that followed. A study of both past and present, ORIGIN explores how genetics is currently being used to construct narratives that profoundly impact Indigenous peoples of the Americas. It serves as a primer for anyone interested in how genetics has become entangled with identity in the way that society addresses the question "Who is indigenous?"
Author: Jennifer Raff
Publisher: Twelve
ISBN: 153874970X
Size: 50.90 MB
Format: PDF, ePub, Docs
Release Date: 2022-02-08
Category: Science
Language: en
View: 6509
Status: Available
Get Book
Book Description
Download PDF Origin eBook. You can read online on your kindle, Android, iPhone, iPad. AN INSTANT NEW YORK TIMES BESTSELLER! From celebrated anthropologist Jennifer Raff comes the untold story—and fascinating mystery—of how humans migrated to the Americas. ORIGIN is the story of who the first peoples in the Americas were, how and why they made the crossing, how they dispersed south, and how they lived based on a new and powerful kind of evidence: their complete genomes. ORIGIN provides an overview of these new histories throughout North and South America, and a glimpse into how the tools of genetics reveal details about human history and evolution. 20,000 years ago, people crossed a great land bridge from Siberia into Western Alaska and then dispersed southward into what is now called the Americas. Until we venture out to other worlds, this remains the last time our species has populated an entirely new place, and this event has been a subject of deep fascination and controversy. No written records—and scant archaeological evidence—exist to tell us what happened or how it took place. Many different models have been proposed to explain how the Americas were peopled and what happened in the thousands of years that followed. A study of both past and present, ORIGIN explores how genetics is currently being used to construct narratives that profoundly impact Indigenous peoples of the Americas. It serves as a primer for anyone interested in how genetics has become entangled with identity in the way that society addresses the question "Who is indigenous?"
A Brief History Of Everything by Ken Wilber
Book Detail:
Author: Ken Wilber
Publisher: Shambhala Publications
ISBN: 1590304500
Size: 71.69 MB
Format: PDF, ePub, Mobi
Release Date: 2007
Category: Philosophy
Language: en
View: 2468
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everything eBook. You can read online on your kindle, Android, iPhone, iPad. Utilizing a question and answer format, the philosopher and spiritual teacher discusses multiculturalism, political correctness, spiritual enlightenment, gender wars, modern liberation movements, and the course of evolution. Reprint.
Author: Ken Wilber
Publisher: Shambhala Publications
ISBN: 1590304500
Size: 71.69 MB
Format: PDF, ePub, Mobi
Release Date: 2007
Category: Philosophy
Language: en
View: 2468
Status: Available
Get Book
Book Description
Download PDF A Brief History Of Everything eBook. You can read online on your kindle, Android, iPhone, iPad. Utilizing a question and answer format, the philosopher and spiritual teacher discusses multiculturalism, political correctness, spiritual enlightenment, gender wars, modern liberation movements, and the course of evolution. Reprint.
Humankind by Rutger Bregman
Book Detail:
Author: Rutger Bregman
Publisher: Little, Brown
ISBN: 0316418552
Size: 32.90 MB
Format: PDF, ePub
Release Date: 2020-06-02
Category: History
Language: en
View: 1390
Status: Available
Get Book
Book Description
Download PDF Humankind eBook. You can read online on your kindle, Android, iPhone, iPad. AN INSTANT NEW YORK TIMES BESTSELLER The “lively” (The New Yorker), “convincing” (Forbes), and “riveting pick-me-up we all need right now” (People) that proves humanity thrives in a crisis and that our innate kindness and cooperation have been the greatest factors in our long-term success as a species. If there is one belief that has united the left and the right, psychologists and philosophers, ancient thinkers and modern ones, it is the tacit assumption that humans are bad. It's a notion that drives newspaper headlines and guides the laws that shape our lives. From Machiavelli to Hobbes, Freud to Pinker, the roots of this belief have sunk deep into Western thought. Human beings, we're taught, are by nature selfish and governed primarily by self-interest. But what if it isn't true? International bestseller Rutger Bregman provides new perspective on the past 200,000 years of human history, setting out to prove that we are hardwired for kindness, geared toward cooperation rather than competition, and more inclined to trust rather than distrust one another. In fact this instinct has a firm evolutionary basis going back to the beginning of Homo sapiens. From the real-life Lord of the Flies to the solidarity in the aftermath of the Blitz, the hidden flaws in the Stanford prison experiment to the true story of twin brothers on opposite sides who helped Mandela end apartheid, Bregman shows us that believing in human generosity and collaboration isn't merely optimistic—it's realistic. Moreover, it has huge implications for how society functions. When we think the worst of people, it brings out the worst in our politics and economics. But if we believe in the reality of humanity's kindness and altruism, it will form the foundation for achieving true change in society, a case that Bregman makes convincingly with his signature wit, refreshing frankness, and memorable storytelling. "The Sapiens of 2020." —The Guardian "Humankind made me see humanity from a fresh perspective." —Yuval Noah Harari, author of the #1 bestseller Sapiens Longlisted for the 2021 Andrew Carnegie Medal for Excellence in Nonfiction One of the Washington Post's 50 Notable Nonfiction Works in 2020
Author: Rutger Bregman
Publisher: Little, Brown
ISBN: 0316418552
Size: 32.90 MB
Format: PDF, ePub
Release Date: 2020-06-02
Category: History
Language: en
View: 1390
Status: Available
Get Book
Book Description
Download PDF Humankind eBook. You can read online on your kindle, Android, iPhone, iPad. AN INSTANT NEW YORK TIMES BESTSELLER The “lively” (The New Yorker), “convincing” (Forbes), and “riveting pick-me-up we all need right now” (People) that proves humanity thrives in a crisis and that our innate kindness and cooperation have been the greatest factors in our long-term success as a species. If there is one belief that has united the left and the right, psychologists and philosophers, ancient thinkers and modern ones, it is the tacit assumption that humans are bad. It's a notion that drives newspaper headlines and guides the laws that shape our lives. From Machiavelli to Hobbes, Freud to Pinker, the roots of this belief have sunk deep into Western thought. Human beings, we're taught, are by nature selfish and governed primarily by self-interest. But what if it isn't true? International bestseller Rutger Bregman provides new perspective on the past 200,000 years of human history, setting out to prove that we are hardwired for kindness, geared toward cooperation rather than competition, and more inclined to trust rather than distrust one another. In fact this instinct has a firm evolutionary basis going back to the beginning of Homo sapiens. From the real-life Lord of the Flies to the solidarity in the aftermath of the Blitz, the hidden flaws in the Stanford prison experiment to the true story of twin brothers on opposite sides who helped Mandela end apartheid, Bregman shows us that believing in human generosity and collaboration isn't merely optimistic—it's realistic. Moreover, it has huge implications for how society functions. When we think the worst of people, it brings out the worst in our politics and economics. But if we believe in the reality of humanity's kindness and altruism, it will form the foundation for achieving true change in society, a case that Bregman makes convincingly with his signature wit, refreshing frankness, and memorable storytelling. "The Sapiens of 2020." —The Guardian "Humankind made me see humanity from a fresh perspective." —Yuval Noah Harari, author of the #1 bestseller Sapiens Longlisted for the 2021 Andrew Carnegie Medal for Excellence in Nonfiction One of the Washington Post's 50 Notable Nonfiction Works in 2020